Have questions? Visit https://www.reddit.com/r/SNPedia

rs749737706

From SNPedia

ClinVar
Risk rs749737706(;)
Alt rs749737706(;)
Reference rs749737706(GCATGCCATTGGGACAGCCTCAGGTTTCT;GCATGCCATTGGGACAGCCTCAGGTTTCT)
Significance Pathogenic
Disease Meckel-Gruber syndrome
Variation info
Gene MKS1
CLNDBN Meckel-Gruber syndrome
Reversed 0
HGVS NC_000017.10:g.56283914_56283942del29
CLNSRC OMIM Allelic Variant
CLNACC RCV000168467.1,