Have questions? Visit https://www.reddit.com/r/SNPedia

rs751570838

From SNPedia

Orientationplus
Stabilizedplus
Geno Mag Summary
(-;GGCTCCATGCTGCTCCCCGCCGCC) 5 Malignant melanoma predisposing mutation
(GGCTCCATGCTGCTCCCCGCCGCC;GGCTCCATGCTGCTCCCCGCCGCC) 0 common/normal


Make rs751570838(-;-)
ReferenceGRCh38.p2 38.2/147
Chromosome9
Position21974796
GeneCDKN2A
is asnp
is mentioned by
dbSNPrs751570838
ebirs751570838
HLIrs751570838
Exacrs751570838
Varsomers751570838
Maprs751570838
PheGenIrs751570838
hapmaprs751570838
1000 genomesrs751570838
hgdprs751570838
ensemblrs751570838
gopubmedrs751570838
geneviewrs751570838
scholarrs751570838
googlers751570838
pharmgkbrs751570838
gwascentralrs751570838
openSNPrs751570838
23andMers751570838
23andMe allrs751570838
SNP Nexus

SNPshotrs751570838
SNPdbers751570838
MSV3drs751570838
GWAS Ctlgrs751570838
Max Magnitude5
rs751570838, also known as c.9_32del24, represents a rare mutation in the CDKN2A gene on chromosome 9.

The rs751570838(-) allele is considered pathogenic in a dominant manner for malignant melanoma, based on sources in ClinVar and elsewhere. CDKN2A mutations may also predispose to other types of cancer.[PMID 12072543OA-icon.png],[PMID 16234564OA-icon.png]

ClinVar
Risk rs751570838(;)
Alt rs751570838(;)
Reference rs751570838(GGCTCCATGCTGCTCCCCGCCGCC;GGCTCCATGCTGCTCCCCGCCGCC)
Significance Unknown
Disease Hereditary cutaneous melanoma
Variation info
Gene CDKN2A
CLNDBN Hereditary cutaneous melanoma
Reversed 0
HGVS NC_000009.11:g.21974795_21974818del24
CLNSRC
CLNACC RCV000197052.1,