rs751570838
From SNPedia
Orientation | plus |
Stabilized | plus |
Geno | Mag | Summary |
---|---|---|
(-;GGCTCCATGCTGCTCCCCGCCGCC) | 5 | Malignant melanoma predisposing mutation |
(GGCTCCATGCTGCTCCCCGCCGCC;GGCTCCATGCTGCTCCCCGCCGCC) | 0 | common/normal |
Make rs751570838(-;-) |
Reference | GRCh38.p2 38.2/147 |
Chromosome | 9 |
Position | 21974796 |
Gene | CDKN2A |
is a | snp |
is | mentioned by |
dbSNP | rs751570838 |
dbSNP (classic) | rs751570838 |
ClinGen | rs751570838 |
ebi | rs751570838 |
HLI | rs751570838 |
Exac | rs751570838 |
Gnomad | rs751570838 |
Varsome | rs751570838 |
LitVar | rs751570838 |
Map | rs751570838 |
PheGenI | rs751570838 |
Biobank | rs751570838 |
1000 genomes | rs751570838 |
hgdp | rs751570838 |
ensembl | rs751570838 |
geneview | rs751570838 |
scholar | rs751570838 |
rs751570838 | |
pharmgkb | rs751570838 |
gwascentral | rs751570838 |
openSNP | rs751570838 |
23andMe | rs751570838 |
SNPshot | rs751570838 |
SNPdbe | rs751570838 |
MSV3d | rs751570838 |
GWAS Ctlg | rs751570838 |
Max Magnitude | 5 |
rs751570838, also known as c.9_32del24, represents a rare mutation in the CDKN2A gene on chromosome 9.
The rs751570838(-) allele is considered pathogenic in a dominant manner for malignant melanoma, based on sources in ClinVar and elsewhere. CDKN2A mutations may also predispose to other types of cancer.[PMID 12072543],[PMID 16234564]
ClinVar | |
---|---|
Risk | rs751570838(-;-) |
Alt | rs751570838(-;-) |
Reference | Rs751570838(GGCTCCATGCTGCTCCCCGCCGCC;GGCTCCATGCTGCTCCCCGCCGCC) |
Significance | Unknown |
Disease | Hereditary cutaneous melanoma Melanoma-pancreatic cancer syndrome not specified |
Variation | info |
Gene | CDKN2A |
CLNDBN | Hereditary cutaneous melanoma Melanoma-pancreatic cancer syndrome not specified |
Reversed | 0 |
HGVS | NC_000009.11:g.21974795_21974818del24 |
CLNSRC | |
CLNACC | RCV000197052.2, RCV000409781.1, RCV000480652.1, |