Have questions? Visit https://www.reddit.com/r/SNPedia

rs751570838(-;GGCTCCATGCTGCTCCCCGCCGCC)

From SNPedia

Malignant melanoma predisposing mutation
Is agenotype
ofrs751570838
GeneCDKN2A
Chromosome9
Position21,974,796
mentionedby
Magnitude5
ReputeBad
Geno Mag Summary
(-;GGCTCCATGCTGCTCCCCGCCGCC) 5 Malignant melanoma predisposing mutation
(GGCTCCATGCTGCTCCCCGCCGCC;GGCTCCATGCTGCTCCCCGCCGCC) 0 common/normal

see rs751570838