Have questions? Visit https://www.reddit.com/r/SNPedia

rs768265778

From SNPedia

Mentioned as a pathogenic/likely pathogenic mutation associated with cancer predisposition in [PMID 26681312OA-icon.png]
ClinVar
Risk rs768265778(;)
Alt rs768265778(;)
Reference rs768265778(CTACTCATGGTGAGGGAGCT;CTACTCATGGTGAGGGAGCT)
Significance Unknown
Disease Oligodontia-colorectal cancer syndrome
Variation info
Gene
CLNDBN Oligodontia-colorectal cancer syndrome
Reversed 0
HGVS NC_000017.10:g.63554731_63554750del20
CLNSRC
CLNACC RCV000228766.1,