Have questions? Visit https://www.reddit.com/r/SNPedia

rs786200943

From SNPedia

ClinVar
Risk rs786200943(;)
Alt rs786200943(;)
Reference rs786200943(TGCTCCCGCTCCAGGGCGCGCC;TGCTCCCGCTCCAGGGCGCGCC)
Significance Pathogenic
Disease Spondyloepimetaphyseal dysplasia with joint laxity
Variation info
Gene B3GALT6 SDF4
CLNDBN Spondyloepimetaphyseal dysplasia with joint laxity, type 1, with fractures
Reversed 1
HGVS NC_000001.10:g.1167981_1168002del22
CLNSRC OMIM Allelic Variant
CLNACC RCV000054403.4,