Have questions? Visit https://www.reddit.com/r/SNPedia

rs786202415

From SNPedia

ClinVar
Risk rs786202415(;)
Alt rs786202415(;)
Reference rs786202415(AACAGAAGTTCAGCTTCGGTTT;AACAGAAGTTCAGCTTCGGTTT)
Significance Pathogenic
Disease Hereditary cancer-predisposing syndrome
Variation info
Gene BRIP1
CLNDBN Hereditary cancer-predisposing syndrome
Reversed 1
HGVS NC_000017.10:g.59876550_59876571del22
CLNSRC
CLNACC RCV000165215.1,