Have questions? Visit https://www.reddit.com/r/SNPedia

rs786204125

From SNPedia

ClinVar
Risk rs786204125(GCTACTGCACAAGCTGCAGCAGCTGCCC;GCTACTGCACAAGCTGCAGCAGCTGCCC)
Alt rs786204125(GCTACTGCACAAGCTGCAGCAGCTGCCC;GCTACTGCACAAGCTGCAGCAGCTGCCC)
Reference rs786204125(;)
Significance Pathogenic
Disease Juvenile polyposis syndrome
Variation info
Gene SMAD4
CLNDBN Juvenile polyposis syndrome
Reversed 0
HGVS NC_000018.9:g.48603052_48603053insGCTACTGCACAAGCTGCAGCAGCTGCCC
CLNSRC
CLNACC RCV000168084.1,