common in clinvar |
Is a | genotype |
of | rs786204125 |
Gene | SMAD4 |
Chromosome | 18 |
Position | 51,076,682 |
mentioned | by |
Magnitude | 0 |
Repute | Good |
Geno | Mag | Summary |
---|---|---|
(-;-) | 0 | common in clinvar |
(-;GCTACTGCACAAGCTGCAGCAGCTGCCC) | 5.1 | Juvenile polyposis syndrome |
Have questions? Visit https://www.reddit.com/r/SNPedia
common in clinvar |
Is a | genotype |
of | rs786204125 |
Gene | SMAD4 |
Chromosome | 18 |
Position | 51,076,682 |
mentioned | by |
Magnitude | 0 |
Repute | Good |
Geno | Mag | Summary |
---|---|---|
(-;-) | 0 | common in clinvar |
(-;GCTACTGCACAAGCTGCAGCAGCTGCCC) | 5.1 | Juvenile polyposis syndrome |