Have questions? Visit https://www.reddit.com/r/SNPedia

rs786204129

From SNPedia

Orientationminus
Stabilizedminus
Geno Mag Summary
(;) 0 common in clinvar
(-;AGAGGAAGCTGTATTTTTC) 3 2-4 fold higher risk for breast cancer, depending on family history
(AGAGGAAGCTGTATTTTTC;AGAGGAAGCTGTATTTTTC) 7 Fanconi anemia, complementation group N


Make rs786204129(-;-)
ReferenceGRCh38.p2 38.2/146
Chromosome16
Position23630187
GenePALB2
is asnp
is mentioned by
dbSNPrs786204129
ebirs786204129
HLIrs786204129
Exacrs786204129
Varsomers786204129
Maprs786204129
PheGenIrs786204129
hapmaprs786204129
1000 genomesrs786204129
hgdprs786204129
ensemblrs786204129
gopubmedrs786204129
geneviewrs786204129
scholarrs786204129
googlers786204129
pharmgkbrs786204129
gwascentralrs786204129
openSNPrs786204129
23andMers786204129
23andMe allrs786204129
SNP Nexus

SNPshotrs786204129
SNPdbers786204129
MSV3drs786204129
GWAS Ctlgrs786204129
Max Magnitude7
ClinVar
Risk rs786204129(AGAGGAAGCTGTATTTTTCC,AGAGGGAAGCTGTATTTTTCC;AGAGGAAGCTGTATTTTTCC,AGAGGGAAGCTGTATTTTTCC)
Alt rs786204129(AGAGGAAGCTGTATTTTTCC,AGAGGGAAGCTGTATTTTTCC;AGAGGAAGCTGTATTTTTCC,AGAGGGAAGCTGTATTTTTCC)
Reference rs786204129(C;C)
Significance Pathogenic
Disease Familial cancer of breast
Variation info
Gene PALB2
CLNDBN Familial cancer of breast
Reversed 1
HGVS NC_000016.9:g.23641508_23641509insGAAAAATACAGCTTCCTCT; NC_000016.9:g.23641509_23641528dup20
CLNSRC
CLNACC RCV000168094.1, RCV000211063.1,