Have questions? Visit https://www.reddit.com/r/SNPedia

rs786204310

From SNPedia

ClinVar
Risk rs786204310(;)
Alt rs786204310(;)
Reference rs786204310(GGCAGGAAGCGAAAAGCTGAGGCCGACCC;GGCAGGAAGCGAAAAGCTGAGGCCGACCC)
Significance Probable-Pathogenic
Disease Rett's disorder
Variation info
Gene MECP2
CLNDBN Rett's disorder
Reversed 1
HGVS NC_000023.11:g.154031046_154031074del29
CLNSRC
CLNACC RCV000168690.1,