Have questions? Visit https://www.reddit.com/r/SNPedia

rs786204532

From SNPedia

ClinVar
Risk rs786204532(C;C)
Alt rs786204532(C;C)
Reference rs786204532(TATATCACAGGCCTCGCCGA;TATATCACAGGCCTCGCCGA)
Significance Probable-Pathogenic
Disease Glycogen storage disease
Variation info
Gene GAA
CLNDBN Glycogen storage disease, type II
Reversed 0
HGVS NC_000017.10:g.78081429_78081448del20insC
CLNSRC Counsyl
CLNACC RCV000169234.1,