Have questions? Visit https://www.reddit.com/r/SNPedia

rs786204550

From SNPedia

ClinVar
Risk
Alt
Reference Rs786204550(ATTACTATCCTTGAGCTCCCC;ATTACTATCCTTGAGCTCCCC)
Significance Probable-Pathogenic
Disease Nephropathic cystinosis
Variation info
Gene CTNS
CLNDBN Nephropathic cystinosis
Reversed 0
HGVS NC_000017.10:g.3552199_3552219del21
CLNSRC
CLNACC RCV000169266.1,