Have questions? Visit https://www.reddit.com/r/SNPedia

rs786204550

From SNPedia

ClinVar
Risk rs786204550(;)
Alt rs786204550(;)
Reference rs786204550(ATTACTATCCTTGAGCTCCCC;ATTACTATCCTTGAGCTCCCC)
Significance Probable-Pathogenic
Disease Cystinosis
Variation info
Gene CTNS
CLNDBN Cystinosis
Reversed 0
HGVS NC_000017.10:g.3552199_3552219del21
CLNSRC
CLNACC RCV000169266.1,