Have questions? Visit https://www.reddit.com/r/SNPedia

rs786204785

From SNPedia

ClinVar
Risk rs786204785(GAGAAGCGGCGGCAGATCAG;GAGAAGCGGCGGCAGATCAG)
Alt rs786204785(GAGAAGCGGCGGCAGATCAG;GAGAAGCGGCGGCAGATCAG)
Reference rs786204785(;)
Significance Pathogenic
Disease Glycogen storage disease
Variation info
Gene PYGL
CLNDBN Glycogen storage disease, type VI
Reversed 1
HGVS NC_000014.8:g.51411077_51411078insCTGATCTGCCGCCGCTTCTC
CLNSRC
CLNACC RCV000169673.1,