Have questions? Visit https://www.reddit.com/r/SNPedia

rs786204964

From SNPedia

ClinVar
Risk rs786204964(;)
Alt rs786204964(;)
Reference rs786204964(GTCTCACCACAGATCTAACAGC;GTCTCACCACAGATCTAACAGC)
Significance Pathogenic
Disease Early infantile epileptic encephalopathy 2
Variation info
Gene CDKL5
CLNDBN Early infantile epileptic encephalopathy 2
Reversed 0
HGVS NC_000023.10:g.18622052_18622073del22
CLNSRC RettBASE (CDKL5)
CLNACC RCV000169991.1,