Have questions? Visit https://www.reddit.com/r/SNPedia

rs786205020

From SNPedia

ClinVar
Risk rs786205020(;)
Alt rs786205020(;)
Reference rs786205020(ACCTCCACCTGAGCCCGAGAGCTCCGAGGAC;ACCTCCACCTGAGCCCGAGAGCTCCGAGGAC)
Significance Pathogenic
Disease Rett syndrome
Variation info
Gene MECP2
CLNDBN Rett syndrome
Reversed 1
HGVS NC_000023.10:g.153296085_153296115del31
CLNSRC
CLNACC RCV000170151.1,