Have questions? Visit https://www.reddit.com/r/SNPedia

rs786205028

From SNPedia

ClinVar
Risk
Alt
Reference Rs786205028(AGGCCATTCCCAAGAAACGGGGCCGAAAGCCGGG;AGGCCATTCCCAAGAAACGGGGCCGAAAGCCGGG)
Significance Pathogenic
Disease Rett syndrome
Variation info
Gene MECP2
CLNDBN Rett syndrome
Reversed 1
HGVS NC_000023.10:g.153296461_153296494del34
CLNSRC
CLNACC RCV000170216.1,