Have questions? Visit https://www.reddit.com/r/SNPedia

rs786205054

From SNPedia

ClinVar
Risk rs786205054(;)
Alt rs786205054(;)
Reference rs786205054(GTGCCAGGCTCTGGCACAGGT;GTGCCAGGCTCTGGCACAGGT)
Significance Pathogenic
Disease Coproporphyria
Variation info
Gene CPOX
CLNDBN Coproporphyria
Reversed 1
HGVS NC_000003.11:g.98311840_98311860del21
CLNSRC OMIM Allelic Variant
CLNACC RCV000000484.4,