Have questions? Visit https://www.reddit.com/r/SNPedia

rs786205062

From SNPedia

ClinVar
Risk rs786205062(;)
Alt rs786205062(;)
Reference rs786205062(GCACCAAGACTACAGTGATTGTCGG;GCACCAAGACTACAGTGATTGTCGG)
Significance Pathogenic
Disease Combined partial 17-alpha-hydroxylase/17
Variation info
Gene CYP17A1
CLNDBN Combined partial 17-alpha-hydroxylase/17,20-lyase deficiency
Reversed 1
HGVS NC_000010.10:g.104596889_104596913del25
CLNSRC OMIM Allelic Variant
CLNACC RCV000001868.5,