Have questions? Visit https://www.reddit.com/r/SNPedia

rs786205172

From SNPedia

ClinVar
Risk rs786205172(GGGCTGGCTGCTTAAGGTCCACCTTA;GGGCTGGCTGCTTAAGGTCCACCTTA)
Alt rs786205172(GGGCTGGCTGCTTAAGGTCCACCTTA;GGGCTGGCTGCTTAAGGTCCACCTTA)
Reference rs786205172(;)
Significance Pathogenic
Disease Cockayne syndrome B
Variation info
Gene ERCC6
CLNDBN Cockayne syndrome B
Reversed 1
HGVS NC_000010.10:g.50678398_50678399insTAAGGTGGACCTTAAGCAGCCAGCCC
CLNSRC
CLNACC RCV000170387.1,