Have questions? Visit https://www.reddit.com/r/SNPedia

rs786205244

From SNPedia

ClinVar
Risk rs786205244(;)
Alt rs786205244(;)
Reference rs786205244(CTCCCGGCCCTGCACATCGC;CTCCCGGCCCTGCACATCGC)
Significance Pathogenic
Disease Spherocytosis
Variation info
Gene ANK1
CLNDBN Spherocytosis, type 1, autosomal recessive
Reversed 1
HGVS NC_000008.10:g.41583352_41583371del20
CLNSRC OMIM Allelic Variant
CLNACC RCV000000543.4,