Have questions? Visit https://www.reddit.com/r/SNPedia

rs786205638

From SNPedia

ClinVar
Risk
Alt
Reference Rs786205638(TTAAAAGATACTTGAGCTGGGACACTCCTCAAGAAGTCATTGCAGTTA;TTAAAAGATACTTGAGCTGGGACACTCCTCAAGAAGTCATTGCAGTTA)
Significance Probable-Pathogenic
Disease not provided
Variation info
Gene DCAF17
CLNDBN not provided
Reversed 0
HGVS NC_000002.11:g.172306382_172306429delTTAAAAGATACTTGAGCTGGGACACTCCTCAAGAAGTCATTGCAGTTA
CLNSRC
CLNACC RCV000171502.1,