Have questions? Visit https://www.reddit.com/r/SNPedia

rs786205699

From SNPedia

ClinVar
Risk
Alt
Reference Rs786205699(ACATGCCGTCAGCACGCACGGCGCTAGCGCGCGC;ACATGCCGTCAGCACGCACGGCGCTAGCGCGCGC)
Significance Pathogenic
Disease Burn-McKeown syndrome
Variation info
Gene TXNL4A
CLNDBN Burn-McKeown syndrome
Reversed 1
HGVS NC_000018.9:g.77748604_77748637del34
CLNSRC
CLNACC RCV000170537.2,