Have questions? Visit https://www.reddit.com/r/SNPedia

rs786205876

From SNPedia

ClinVar
Risk
Alt
Reference Rs786205876(TAAAGCAAGACCGAGAGCACCTGT;TAAAGCAAGACCGAGAGCACCTGT)
Significance Pathogenic
Disease Antley-Bixler syndrome with genital anomalies and disordered steroidogenesis
Variation info
Gene POR
CLNDBN Antley-Bixler syndrome with genital anomalies and disordered steroidogenesis
Reversed 0
HGVS NC_000007.13:g.75615496_75615519del24
CLNSRC OMIM Allelic Variant
CLNACC RCV000018412.25,