Have questions? Visit https://www.reddit.com/r/SNPedia

rs794726792

From SNPedia

ClinVar
Risk rs794726792(;)
Alt rs794726792(;)
Reference rs794726792(GATACCTTCAGTTGGGCTTT;GATACCTTCAGTTGGGCTTT)
Significance Pathogenic
Disease Severe myoclonic epilepsy in infancy
Variation info
Gene SCN1A
CLNDBN Severe myoclonic epilepsy in infancy
Reversed 1
HGVS NC_000002.11:g.166904192_166904211del20
CLNSRC Peking University
CLNACC RCV000180908.1,