Have questions? Visit https://www.reddit.com/r/SNPedia

rs794727063

From SNPedia

ClinVar
Risk rs794727063(;)
Alt rs794727063(;)
Reference rs794727063(GAGCATAGGGCAAGGGATGGCAGCTA;GAGCATAGGGCAAGGGATGGCAGCTA)
Significance Pathogenic
Disease Early infantile epileptic encephalopathy 2
Variation info
Gene CDKL5
CLNDBN Early infantile epileptic encephalopathy 2
Reversed 0
HGVS NC_000023.10:g.18622935_18622960delATAGGGCAAGGGATGGCAGCTAGAGC
CLNSRC
CLNACC RCV000174312.1,