Have questions? Visit https://www.reddit.com/r/SNPedia

rs794727252

From SNPedia

ClinVar
Risk rs794727252(;)
Alt rs794727252(;)
Reference rs794727252(AGCCTGTTGAGTGGGCTGGGCCC;AGCCTGTTGAGTGGGCTGGGCCC)
Significance Pathogenic
Disease Niemann-Pick disease
Variation info
Gene SMPD1
CLNDBN Niemann-Pick disease, type B
Reversed 0
HGVS NC_000011.9:g.6413080_6413102delTGTTGAGTGGGCTGGGCCCAGCC
CLNSRC
CLNACC RCV000175621.1,