Have questions? Visit https://www.reddit.com/r/SNPedia

rs794727644

From SNPedia

ClinVar
Risk rs794727644(;)
Alt rs794727644(;)
Reference rs794727644(ATGGGCACCCTGATCTCGGAGC;ATGGGCACCCTGATCTCGGAGC)
Significance Pathogenic
Disease Three M syndrome 1
Variation info
Gene CUL7
CLNDBN Three M syndrome 1
Reversed 1
HGVS NC_000006.11:g.43019020_43019041delGCTCCGAGATCAGGGTGCCCAT
CLNSRC
CLNACC RCV000178294.1,