Have questions? Visit https://www.reddit.com/r/SNPedia

rs794728563

From SNPedia

ClinVar
Risk
Alt
Reference Rs794728563(CGCGCCCGGCGCCCCAGGTCCCG;CGCGCCCGGCGCCCCAGGTCCCG)
Significance Pathogenic
Disease Cardiac arrhythmia
Variation info
Gene KCNQ1
CLNDBN Cardiac arrhythmia
Reversed 0
HGVS NC_000011.9:g.2466493_2466515del23
CLNSRC
CLNACC RCV000182290.1,