Have questions? Visit https://www.reddit.com/r/SNPedia

rs794729327

From SNPedia

ClinVar
Risk rs794729327(AACCT;AACCT)
Alt rs794729327(AACCT;AACCT)
Reference rs794729327(GACCCAGCGACTGCTAGAGATCC;GACCCAGCGACTGCTAGAGATCC)
Significance Pathogenic
Disease not provided
Variation info
Gene TTN TTN-AS1
CLNDBN not provided
Reversed 1
HGVS NC_000002.11:g.179463480_179463502del23insAGGTT
CLNSRC
CLNACC RCV000184315.1,