Have questions? Visit https://www.reddit.com/r/SNPedia

rs794729357

From SNPedia

ClinVar
Risk rs794729357(TGTTATTAGTGATATATCTAA;TGTTATTAGTGATATATCTAA)
Alt rs794729357(TGTTATTAGTGATATATCTAA;TGTTATTAGTGATATATCTAA)
Reference rs794729357(CC;CC)
Significance Pathogenic
Disease not provided
Variation info
Gene TTN TTN-AS1
CLNDBN not provided
Reversed 1
HGVS NC_000002.11:g.179422662_179422663delGGinsTTAGATATATCACTAATAACA
CLNSRC
CLNACC RCV000184350.1,