Have questions? Visit https://www.reddit.com/r/SNPedia

rs796051920

From SNPedia

ClinVar
Risk
Alt
Reference Rs796051920(CGTGGGCATGCATGACCTTGG;CGTGGGCATGCATGACCTTGG)
Significance Pathogenic
Disease not provided
Variation info
Gene DLG4 ACADVL
CLNDBN not provided
Reversed 0
HGVS NC_000017.10:g.7124886_7124906del21
CLNSRC
CLNACC RCV000185744.1,