Have questions? Visit https://www.reddit.com/r/SNPedia

rs796051932(;)

From SNPedia

common in clinvar
Is agenotype
ofrs796051932
GeneASL
Chromosome7
Position66,086,776
mentioned
Magnitude0
ReputeGood
Geno Mag Summary
(;) 0 common in clinvar
(-;TGGCACTGACCCGAGACTCTGAGCG) 3 Unaffected carrier of one bad argininosuccinate lyase allele
(TGGCACTGACCCGAGACTCTGAGCG;TGGCACTGACCCGAGACTCTGAGCG) 8 Argininosuccinate lyase deficiency