Have questions? Visit https://www.reddit.com/r/SNPedia

rs796052070

From SNPedia

ClinVar
Risk rs796052070(;)
Alt rs796052070(;)
Reference rs796052070(CCAGGAGCCCGAGTGCACCCGATGA;CCAGGAGCCCGAGTGCACCCGATGA)
Significance Pathogenic
Disease Primary hyperoxaluria
Variation info
Gene AGXT
CLNDBN Primary hyperoxaluria, type I
Reversed 0
HGVS NC_000002.11:g.241810057_241810081del25
CLNSRC
CLNACC RCV000186390.1,