Have questions? Visit https://www.reddit.com/r/SNPedia

rs796053503

From SNPedia

ClinVar
Risk
Alt
Reference Rs796053503(TGCTGGTGGACCTGGCAGAGGGC;TGCTGGTGGACCTGGCAGAGGGC)
Significance Pathogenic
Disease not provided
Variation info
Gene TSC2
CLNDBN not provided
Reversed 0
HGVS NC_000016.9:g.2114364_2114386del23
CLNSRC
CLNACC RCV000190057.1,