Have questions? Visit https://www.reddit.com/r/SNPedia

rs797045725

From SNPedia

ClinVar
Risk
Alt
Reference Rs797045725(AGCGAGACCTCGGCGAGGAGCTGGAGGCCCTAAAGACAGAGCTGGAAGA;AGCGAGACCTCGGCGAGGAGCTGGAGGCCCTAAAGACAGAGCTGGAAGA)
Significance Pathogenic
Disease Aortic aneurysm
Variation info
Gene MYH11
CLNDBN Aortic aneurysm, familial thoracic 4
Reversed 1
HGVS NC_000016.9:g.15829259_15829307del49
CLNSRC
CLNACC RCV000194899.1,