Have questions? Visit https://www.reddit.com/r/SNPedia

rs797045841

From SNPedia

ClinVar
Risk
Alt
Reference Rs797045841(ATGGACCTCTCCTCCAGGAGTG;ATGGACCTCTCCTCCAGGAGTG)
Significance Pathogenic
Disease Band-like calcification with simplified gyration and polymicrogyria
Variation info
Gene OCLN
CLNDBN Band-like calcification with simplified gyration and polymicrogyria
Reversed 0
HGVS NC_000005.9:g.68805090_68805111del22
CLNSRC
CLNACC RCV000192882.1,