Have questions? Visit https://www.reddit.com/r/SNPedia

rs797045954

From SNPedia

ClinVar
Risk rs797045954(;)
Alt rs797045954(;)
Reference rs797045954(ACCAGTTCCCCCTCGAGGCC;ACCAGTTCCCCCTCGAGGCC)
Significance Pathogenic
Disease Nager syndrome
Variation info
Gene SF3B4
CLNDBN Nager syndrome
Reversed 1
HGVS NC_000001.10:g.149895460_149895479del20
CLNSRC
CLNACC RCV000192855.1,