Have questions? Visit https://www.reddit.com/r/SNPedia

rs80338725

From SNPedia

Orientationminus
Stabilizedminus
Geno Mag Summary
(;) 0 common in clinvar
(GCT;GCT) 0 common in clinvar
Make rs80338725(-;-)
Make rs80338725(-;GAGATTACAGGTGGCTGCCCGGG)
Make rs80338725(GAGATTACAGGTGGCTGCCCGGG;GAGATTACAGGTGGCTGCCCGGG)
ReferenceGRCh38 38.1/141
Chromosome7
Position96121928
GeneSLC25A13
is asnp
is mentioned by
dbSNPrs80338725
ebirs80338725
HLIrs80338725
Exacrs80338725
Varsomers80338725
Maprs80338725
PheGenIrs80338725
hapmaprs80338725
1000 genomesrs80338725
hgdprs80338725
ensemblrs80338725
gopubmedrs80338725
geneviewrs80338725
scholarrs80338725
googlers80338725
pharmgkbrs80338725
gwascentralrs80338725
openSNPrs80338725
23andMers80338725
23andMe allrs80338725
SNP Nexus

SNPshotrs80338725
SNPdbers80338725
MSV3drs80338725
GWAS Ctlgrs80338725
Max Magnitude0
OMIM603859
Desc
Variant0003
Relatedalso
ClinVar
Risk rs80338725(GAGATTACAGGTGGCTGCCCGGG;GAGATTACAGGTGGCTGCCCGGG)
Alt rs80338725(GAGATTACAGGTGGCTGCCCGGG;GAGATTACAGGTGGCTGCCCGGG)
Reference rs80338725(GCT;GCT)
Significance Pathogenic
Disease Citrullinemia type II
Variation info
Gene SLC25A13
CLNDBN Citrullinemia type II
Reversed 1
HGVS NC_000007.13:g.95751241_95751263dup23
CLNSRC OMIM Allelic Variant
CLNACC RCV000006371.3,


[PMID 10369257] The gene mutated in adult-onset type II citrullinaemia encodes a putative mitochondrial carrier protein.