Have questions? Visit https://www.reddit.com/r/SNPedia

rs80356768

From SNPedia

OMIM606463
Desc
Variant0023
Relatedalso
ClinVar
Risk rs80356768(;)
Alt rs80356768(;)
Reference rs80356768(TTGCCCTGAACCCCGAAGGAGGACCCAATTGGGTGCGTAACTTTGTCGACAGTCC;TTGCCCTGAACCCCGAAGGAGGACCCAATTGGGTGCGTAACTTTGTCGACAGTCC)
Significance Pathogenic
Disease Gaucher disease Gaucher disease Gaucher's disease
Variation info
Gene GBA
CLNDBN Gaucher disease, perinatal lethal Gaucher disease Gaucher's disease, type 1
Reversed 1
HGVS NC_000001.10:g.155205541_155205595del55
CLNSRC OMIM Allelic Variant dbVar
CLNACC RCV000004555.4, RCV000020147.2, RCV000173718.1,


[PMID 8432537] Identification of six new Gaucher disease mutations.


[PMID 10685993OA-icon.png] Type 2 Gaucher disease: the collodion baby phenotype revisited.