Have questions? Visit https://www.reddit.com/r/SNPedia

rs80356802

From SNPedia

ClinVar
Risk rs80356802(;)
Alt rs80356802(;)
Reference rs80356802(GTAAGTCCGGATTATCCAACCATTGTTACTTACCTGGGATGGGAAACACATTTGAAGTCTTACAGATGAATTTTCCAACCGTAG;GTAAGTCCGGATTATCCAACCATTGTTACTTACCTGGGATGGGAAACACATTTGAAGTCTTACAGATGAATTTTCCAACCGTAG)
Significance Pathogenic
Disease Carnitine palmitoyltransferase I deficiency
Variation info
Gene CPT1A
CLNDBN Carnitine palmitoyltransferase I deficiency
Reversed 1
HGVS NC_000011.9:g.68542700_68542783del84
CLNSRC GeneReviews
CLNACC RCV000034299.2,


[PMID 12189492] Organization of the human liver carnitine palmitoyltransferase 1 gene ( CPT1A) and identification of novel mutations in hypoketotic hypoglycaemia.