Have questions? Visit https://www.reddit.com/r/SNPedia

rs80358236

From SNPedia

ClinVar
Risk rs80358236(;)
Alt rs80358236(;)
Reference rs80358236(ATGCCTCTGGAATGGGAAGACACCTATGGAATTGTCCTGCTTTCTGGAGTGAAGTATAAGAAGGGTGGCCTTGTGATCAATGAA;ATGCCTCTGGAATGGGAAGACACCTATGGAATTGTCCTGCTTTCTGGAGTGAAGTATAAGAAGGGTGGCCTTGTGATCAATGAA)
Significance Pathogenic
Disease Autoimmune lymphoproliferative syndrome
Variation info
Gene FASLG
CLNDBN Autoimmune lymphoproliferative syndrome, type 1b
Reversed 0
HGVS NC_000001.10:g.172634782_172634865del84
CLNSRC OMIM Allelic Variant dbVar
CLNACC RCV000017959.28,


[PMID 8787672OA-icon.png] Fas ligand mutation in a patient with systemic lupus erythematosus and lymphoproliferative disease.