Have questions? Visit https://www.reddit.com/r/SNPedia


From SNPedia

Geno Mag Summary
(-;TAGGACCAATAAGTCTTAATTGGTTT) 6 BRCA2 variant considered pathogenic for breast cancer
Make rs80359637(-;-)
ReferenceGRCh38 38.1/142
is asnp
is mentioned by
1000 genomesrs80359637
23andMe allrs80359637
SNP Nexus

GWAS Ctlgrs80359637
Max Magnitude6
rs80359637, also known as 299del26, c.71_96del and p.Leu24_Phe32?fs, is a variant in the BRCA2 gene considered pathogenic for breast cancer in ClinVar.
Significance Pathogenic
Disease Breast-ovarian cancer
Variation info
Gene BRCA2
CLNDBN Breast-ovarian cancer, familial 2
Reversed 0
HGVS NC_000013.10:g.32893217_32893242del26
CLNSRC Breast Cancer Information Core (BRCA2)
CLNACC RCV000113090.4,