Have questions? Visit https://www.reddit.com/r/SNPedia

rs80359637

From SNPedia

Orientationplus
Stabilizedplus
Geno Mag Summary
(-;TAGGACCAATAAGTCTTAATTGGTTT) 6 BRCA2 variant considered pathogenic for breast cancer
(TTTAGGACCAATAAGTCTTAATTGGT;TTTAGGACCAATAAGTCTTAATTGGT) 0 common in clinvar
Make rs80359637(-;-)
Make rs80359637(TAGGACCAATAAGTCTTAATTGGTTT;TAGGACCAATAAGTCTTAATTGGTTT)
ReferenceGRCh38 38.1/142
Chromosome13
Position32319080
GeneBRCA2
is asnp
is mentioned by
dbSNPrs80359637
ebirs80359637
HLIrs80359637
Exacrs80359637
Varsomers80359637
Maprs80359637
PheGenIrs80359637
hapmaprs80359637
1000 genomesrs80359637
hgdprs80359637
ensemblrs80359637
gopubmedrs80359637
geneviewrs80359637
scholarrs80359637
googlers80359637
pharmgkbrs80359637
gwascentralrs80359637
openSNPrs80359637
23andMers80359637
23andMe allrs80359637
SNP Nexus

SNPshotrs80359637
SNPdbers80359637
MSV3drs80359637
GWAS Ctlgrs80359637
Max Magnitude6
rs80359637, also known as 299del26, c.71_96del and p.Leu24_Phe32?fs, is a variant in the BRCA2 gene considered pathogenic for breast cancer in ClinVar.
ClinVar
Risk rs80359637(;)
Alt rs80359637(;)
Reference rs80359637(TTTAGGACCAATAAGTCTTAATTGGT;TTTAGGACCAATAAGTCTTAATTGGT)
Significance Other
Disease Breast-ovarian cancer
Variation info
Gene BRCA2
CLNDBN Breast-ovarian cancer, familial 2
Reversed 0
HGVS NC_000013.10:g.32893217_32893242del26
CLNSRC Breast Cancer Information Core (BRCA2)
CLNACC RCV000113090.3,