Have questions? Visit https://www.reddit.com/r/SNPedia

rs80359690

From SNPedia

Orientationplus
Stabilizedplus
Geno Mag Summary
(-;GGCTATAAAAAAGATAATGGAAA) 6 BRCA2 variant considered pathogenic for breast cancer
(GGCTATAAAAAAGATAATGGAAA;GGCTATAAAAAAGATAATGGAAA) 0 common in clinvar


Make rs80359690(-;-)
ReferenceGRCh38 38.1/142
Chromosome13
Position32363212
GeneBRCA2
is asnp
is mentioned by
dbSNPrs80359690
ebirs80359690
HLIrs80359690
Exacrs80359690
Varsomers80359690
Maprs80359690
PheGenIrs80359690
hapmaprs80359690
1000 genomesrs80359690
hgdprs80359690
ensemblrs80359690
gopubmedrs80359690
geneviewrs80359690
scholarrs80359690
googlers80359690
pharmgkbrs80359690
gwascentralrs80359690
openSNPrs80359690
23andMers80359690
23andMe allrs80359690
SNP Nexus

SNPshotrs80359690
SNPdbers80359690
MSV3drs80359690
GWAS Ctlgrs80359690
Max Magnitude6
rs80359690, also known as 8238del23, c.8010_8032del and p.Ser2670_Arg2678?fs, is a variant in the BRCA2 gene considered pathogenic for breast cancer in ClinVar.
ClinVar
Risk rs80359690(;)
Alt rs80359690(;)
Reference rs80359690(GGCTATAAAAAAGATAATGGAAA;GGCTATAAAAAAGATAATGGAAA)
Significance Pathogenic
Disease Breast-ovarian cancer
Variation info
Gene BRCA2
CLNDBN Breast-ovarian cancer, familial 2
Reversed 0
HGVS NC_000013.10:g.32937349_32937371del23
CLNSRC Breast Cancer Information Core (BRCA2)
CLNACC RCV000113856.1,