Have questions? Visit https://www.reddit.com/r/SNPedia

rs80359736

From SNPedia

ClinVar
Risk rs80359736(;)
Alt rs80359736(;)
Reference rs80359736(TCCATCATCAGATTTATATTCTCTGTTAACAGAAGGAAAGAGATACAGAATTTATCATCTTGCAACTTCAAAATCTAAAAGTAAATCTGAAAGAGCTAACATACAGTTAGCAGCGACAAAAAAAAC;TCCATCATCAGATTTATATTCTCTGTTAACAGAAGGAAAGAGATACAGAATTTATCATCTTGCAACTTCAAAATCTAAAAGTAAATCTGAAAGAGCTAACATACAGTTAGCAGCGACAAAAAAAAC)
"rs80359736(TCCATCATCAGATTTATATTCTCTGTTAACAGAAGGAAAGAGATACAGAATTTATCATCTTGCAACTTCAAAATCTAAAAGTAAATCTGAAAGAGCTAACATACAGTTAGCAGCGACAAAAAAAAC;TCCATCATCAGATTTATATTCTCTGTTAACAGAAGGAAAGAGATACAGAATTTATCATCTTGCAACTTCAAAATCTAAAAGTAAATCTGAAAGAGCTAACATACAGTTAGCAGCGACAAAAAAAAC)" cannot be used as a page name in this wiki.
Significance Other
Disease Breast-ovarian cancer
Variation info
Gene BRCA2
CLNDBN Breast-ovarian cancer, familial 2
Reversed 0
HGVS NC_000013.10:g.32953908_32954033del126
CLNSRC Breast Cancer Information Core (BRCA2)
CLNACC RCV000082997.4,