Have questions? Visit https://www.reddit.com/r/SNPedia

rs80359831

From SNPedia

Orientationminus
Stabilizedminus
Geno Mag Summary
(;) 0 common in clinvar
Make rs80359831(-;-)
Make rs80359831(-;TCCTGCCCACCACGCTCACCACC)
Make rs80359831(TCCTGCCCACCACGCTCACCACC;TCCTGCCCACCACGCTCACCACC)
ReferenceGRCh38 38.1/141
Chromosome1
Position42931131
GeneSLC2A1
is asnp
is mentioned by
dbSNPrs80359831
ebirs80359831
HLIrs80359831
Exacrs80359831
Varsomers80359831
Maprs80359831
PheGenIrs80359831
hapmaprs80359831
1000 genomesrs80359831
hgdprs80359831
ensemblrs80359831
gopubmedrs80359831
geneviewrs80359831
scholarrs80359831
googlers80359831
pharmgkbrs80359831
gwascentralrs80359831
openSNPrs80359831
23andMers80359831
23andMe allrs80359831
SNP Nexus

SNPshotrs80359831
SNPdbers80359831
MSV3drs80359831
GWAS Ctlgrs80359831
Max Magnitude0
ClinVar
Risk rs80359831(TCCTGCCCACCACGCTCACCACC;TCCTGCCCACCACGCTCACCACC)
Alt rs80359831(TCCTGCCCACCACGCTCACCACC;TCCTGCCCACCACGCTCACCACC)
Reference rs80359831(;)
Significance Pathogenic
Disease Glucose transporter type 1 deficiency syndrome
Variation info
Gene SLC2A1
CLNDBN Glucose transporter type 1 deficiency syndrome
Reversed 1
HGVS NC_000001.10:g.43396802_43396803insGGTGGTGAGCGTGGTGGGCAGGA
CLNSRC
CLNACC


[PMID 15622525] Glut-1 deficiency syndrome: clinical, genetic, and therapeutic aspects.