Have questions? Visit https://www.reddit.com/r/SNPedia

rs80359871

From SNPedia

Orientationminus
Stabilizedminus
Geno Mag Summary
(-;CGCGTTGAAGAAGTACAAAATGTCATTAA) 6 BRCA1 variant considered pathogenic for breast cancer
(CGCGTTGAAGAAGTACAAAATGTCATTAA;CGCGTTGAAGAAGTACAAAATGTCATTAA) 0 common in clinvar
Make rs80359871(-;-)
Make rs80359871(-;CGCGTTGAAGAAGTACAAAATGTCATTAA)
ReferenceGRCh38 38.1/142
Chromosome17
Position43124050
GeneBRCA1, NBR2
is asnp
is mentioned by
dbSNPrs80359871
ebirs80359871
HLIrs80359871
Exacrs80359871
Varsomers80359871
Maprs80359871
PheGenIrs80359871
hapmaprs80359871
1000 genomesrs80359871
hgdprs80359871
ensemblrs80359871
gopubmedrs80359871
geneviewrs80359871
scholarrs80359871
googlers80359871
pharmgkbrs80359871
gwascentralrs80359871
openSNPrs80359871
23andMers80359871
23andMe allrs80359871
SNP Nexus

SNPshotrs80359871
SNPdbers80359871
MSV3drs80359871
GWAS Ctlgrs80359871
Max Magnitude6
rs80359871, also known as 138del29, c.19_47del and p.Arg7_Asn16?fs, is a variant in the BRCA1 gene considered pathogenic for breast cancer in ClinVar.
ClinVar
Risk rs80359871(;)
Alt rs80359871(;)
Reference rs80359871(CGCGTTGAAGAAGTACAAAATGTCATTAA;CGCGTTGAAGAAGTACAAAATGTCATTAA)
Significance Pathogenic
Disease Breast-ovarian cancer Hereditary cancer-predisposing syndrome
Variation info
Gene NBR2 BRCA1
CLNDBN Breast-ovarian cancer, familial 1 Hereditary cancer-predisposing syndrome
Reversed 1
HGVS NC_000017.10:g.41276067_41276095del29
CLNSRC Breast Cancer Information Core (BRCA1)
CLNACC RCV000111579.1, RCV000163512.1,