Have questions? Visit https://www.reddit.com/r/SNPedia

rs80359872

From SNPedia

rs80359872, also known as 1071del64, c.952_1015del and p.His318_Lys339?fs, is a variant in the BRCA1 gene considered pathogenic for breast cancer in ClinVar.
ClinVar
Risk rs80359872(;)
Alt rs80359872(;)
Reference rs80359872(CATAACAGATGGGCTGGAAGTAAGGAAACATGTAATGATAGGCGGACTCCCAGCACAGAAAAAA;CATAACAGATGGGCTGGAAGTAAGGAAACATGTAATGATAGGCGGACTCCCAGCACAGAAAAAA)
Significance Pathogenic
Disease Breast-ovarian cancer Familial cancer of breast
Variation info
Gene BRCA1
CLNDBN Breast-ovarian cancer, familial 1 Familial cancer of breast
Reversed 1
HGVS NC_000017.10:g.41246533_41246596del64
CLNSRC Breast Cancer Information Core (BRCA1)
CLNACC RCV000031291.4, RCV000049201.2,