Have questions? Visit https://www.reddit.com/r/SNPedia


From SNPedia

Geno Mag Summary
(-;TGTTAGGTTCTGATGACTCACATGATGGGGAGTCTGAATC) 6 BRCA1 variant considered pathogenic for breast cancer

Make rs80359874(-;-)
ReferenceGRCh38 38.1/141
is asnp
is mentioned by
1000 genomesrs80359874
23andMe allrs80359874
SNP Nexus

GWAS Ctlgrs80359874
Max Magnitude6
rs80359874, also known as 1294del40, c.1175_1214del and p.Leu392_Ser405?fs, is a variant in the BRCA1 gene considered pathogenic for breast cancer in ClinVar.
Significance Pathogenic
Disease Breast-ovarian cancer Hereditary breast and ovarian cancer syndrome Hereditary cancer-predisposing syndrome not provided not specified
Variation info
Gene BRCA1
CLNDBN Breast-ovarian cancer, familial 1 Hereditary breast and ovarian cancer syndrome Hereditary cancer-predisposing syndrome not provided not specified
Reversed 1
HGVS NC_000017.10:g.41246334_41246373del40
CLNSRC Breast Cancer Information Core (BRCA1) Children's Hospital of Eastern Ontario OMIM Allelic Variant
CLNACC RCV000019234.14, RCV000047372.5, RCV000131965.3, RCV000159899.2, RCV000238898.1,