Have questions? Visit https://www.reddit.com/r/SNPedia

rs80359874

From SNPedia

Orientationminus
Stabilizedminus
Geno Mag Summary
(-;TGTTAGGTTCTGATGACTCACATGATGGGGAGTCTGAATC) 6 BRCA1 variant considered pathogenic for breast cancer
(TGTTAGGTTCTGATGACTCACATGATGGGGAGTCTGAATC;TGTTAGGTTCTGATGACTCACATGATGGGGAGTCTGAATC) 0 Normal


Make rs80359874(-;-)
ReferenceGRCh38 38.1/141
Chromosome17
Position43094317
GeneBRCA1
is asnp
is mentioned by
dbSNPrs80359874
ebirs80359874
HLIrs80359874
Exacrs80359874
Varsomers80359874
Maprs80359874
PheGenIrs80359874
hapmaprs80359874
1000 genomesrs80359874
hgdprs80359874
ensemblrs80359874
gopubmedrs80359874
geneviewrs80359874
scholarrs80359874
googlers80359874
pharmgkbrs80359874
gwascentralrs80359874
openSNPrs80359874
23andMers80359874
23andMe allrs80359874
SNP Nexus

SNPshotrs80359874
SNPdbers80359874
MSV3drs80359874
GWAS Ctlgrs80359874
Max Magnitude6
rs80359874, also known as 1294del40, c.1175_1214del and p.Leu392_Ser405?fs, is a variant in the BRCA1 gene considered pathogenic for breast cancer in ClinVar.
ClinVar
Risk rs80359874(;)
Alt rs80359874(;)
Reference rs80359874(TGTTAGGTTCTGATGACTCACATGATGGGGAGTCTGAATC;TGTTAGGTTCTGATGACTCACATGATGGGGAGTCTGAATC)
Significance Pathogenic
Disease Breast-ovarian cancer Hereditary breast and ovarian cancer syndrome Hereditary cancer-predisposing syndrome not provided not specified
Variation info
Gene BRCA1
CLNDBN Breast-ovarian cancer, familial 1 Hereditary breast and ovarian cancer syndrome Hereditary cancer-predisposing syndrome not provided not specified
Reversed 1
HGVS NC_000017.10:g.41246334_41246373del40
CLNSRC Breast Cancer Information Core (BRCA1) OMIM Allelic Variant
CLNACC RCV000019234.12, RCV000047372.5, RCV000131965.2, RCV000159899.2, RCV000238898.1,