Have questions? Visit https://www.reddit.com/r/SNPedia

rs80359875

From SNPedia

rs80359875, also known as 1205del56, c.1086_1141del and p.Glu362_Lys381?fs, is a variant in the BRCA1 gene considered pathogenic for breast cancer in ClinVar.
ClinVar
Risk rs80359875(;)
Alt rs80359875(;)
Reference rs80359875(GAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA;GAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA)
Significance Pathogenic
Disease Breast-ovarian cancer
Variation info
Gene BRCA1
CLNDBN Breast-ovarian cancer, familial 1
Reversed 1
HGVS NC_000017.10:g.41246407_41246462del56
CLNSRC Breast Cancer Information Core (BRCA1)
CLNACC RCV000077056.3,