Have questions? Visit https://www.reddit.com/r/SNPedia

rs80359878

From SNPedia

Orientationminus
Stabilizedminus
Geno Mag Summary
(-;TGTGGTGAAGGAGCTTTCATCATTCACC) 6 BRCA1 variant considered pathogenic for breast cancer
(TGTGGTGAAGGAGCTTTCATCATTCACC;TGTGGTGAAGGAGCTTTCATCATTCACC) 0 common in clinvar


Make rs80359878(-;-)
ReferenceGRCh38 38.1/142
Chromosome17
Position43049130
GeneBRCA1
is asnp
is mentioned by
dbSNPrs80359878
ebirs80359878
HLIrs80359878
Exacrs80359878
Varsomers80359878
Maprs80359878
PheGenIrs80359878
hapmaprs80359878
1000 genomesrs80359878
hgdprs80359878
ensemblrs80359878
gopubmedrs80359878
geneviewrs80359878
scholarrs80359878
googlers80359878
pharmgkbrs80359878
gwascentralrs80359878
openSNPrs80359878
23andMers80359878
23andMe allrs80359878
SNP Nexus

SNPshotrs80359878
SNPdbers80359878
MSV3drs80359878
GWAS Ctlgrs80359878
Max Magnitude6
rs80359878, also known as 5489del28, c.5370_5397del and p.Ser1790_Thr1799?fs, is a variant in the BRCA1 gene considered pathogenic for breast cancer in ClinVar.
ClinVar
Risk rs80359878(;)
Alt rs80359878(;)
Reference rs80359878(TGTGGTGAAGGAGCTTTCATCATTCACC;TGTGGTGAAGGAGCTTTCATCATTCACC)
Significance Pathogenic
Disease Breast-ovarian cancer
Variation info
Gene BRCA1
CLNDBN Breast-ovarian cancer, familial 1
Reversed 1
HGVS NC_000017.10:g.41201147_41201174del28
CLNSRC Breast Cancer Information Core (BRCA1)
CLNACC RCV000112630.1,